Skip to content

Latest commit

 

History

120 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

IPknot for predicting RNA pseudoknot structures using integer programming

Requirements

Install

For GLPK,

export PKG_CONFIG_PATH=/path/to/viennarna/lib/pkgconfig:$PKG_CONFIG_PATH
mkdir build && cd build
cmake -DCMAKE_BUILD_TYPE=Release ..  # configure
cmake --build . # build
cmake --install . # install (optional)

For Gurobi, add -DENABLE_GUROBI to the configure step:

cmake -DENABLE_GUROBI -DCMAKE_BUILD_TYPE=Release ..  # configure

For CPLEX, add -DENABLE_CPLEX to the configure step:

cmake -DENABLE_CPLEX -DCMAKE_BUILD_TYPE=Release ..  # configure

For SCIP, add -DENABLE_SCIP to the configure step:

cmake -DENABLE_SCIP -DCMAKE_BUILD_TYPE=Release ..  # configure

For HiGHS, add -DENABLE_HIGHS to the configure step:

cmake -DENABLE_HIGHS -DCMAKE_BUILD_TYPE=Release ..  # configure

Usage

Single sequences

IPknot can take FASTA formatted RNA sequences as input, then predicts their secondary structures including pseudoknots.

% ipknot: [options] fasta
 -h:       show this message
 -t th:    threshold of base-pairing probabilities for each level (default: auto,auto)
 -e model: probabilistic model (default: LinearPartition-C)
 -b:       output the prediction via BPSEQ format

% ipknot drz_Ppac_1_1.fa
>drz_Ppac_1_1
GACUCGCUUGACUGUUCACCUCCCCGUGGUGCGAGUUGGACACCCACCACUCGCAUUCUUCACCUAUUGUUUAAUUGUGCUUGUGGUGGGUGACUGAGAAACAGUC
.[[[[[...(((((((((((.......))))]]]]].((.((((((((((..((((....................))))..)))))))))).))....)))))))

Model

IPknot can calculate the base pairing probability using the following probability models:

  • LinearPartition model with CONTRAfold parameters (LinearPartition-C or lpc) (default)
  • LinearPartition model with ViennaRNA parameters (LinearPartition-V or lpv)
  • McCaskill model with Boltzmann likelihood parameters (Boltzmann)
  • McCaskill model with ViennaRNA parameters (ViennaRNA)
  • CONTRAfold model (CONTRAfold)
  • NUPACK model (NUPACK)

You can specify the model using -e option.

Thresholds

IPknot predicts the pseudoknot structure hierarchically. The -t option is used to specify the base pairing probability threshold for each level. For example, if you run ipknot -t 0.25 -t 0.125 seq.fa, the threshold for the first level is 0.25 and the threshold for the second level is 0.125.

IPknot can search for the best thresholds from multiple combinations of thresholds using pseudo-expected accuracy. For example, ipknot -t 0.5_0.25 -t 0.25_0.125 seq.fa searches for the combination of 0.5 and 0.125 for the first layer and 0.25 and 0.125 for the second layer, and outputs the secondary structure with the maximum pseudo-expected accuracy as the final prediction. By default, -t auto -t auto is specified, where auto means 0.5_0.25_0.125_0.0625.

Aligned sequences

IPknot can also take CLUSTAL formatted RNA alignments produced by CLUSTALW and MAFFT, then predicts their common secondary structures.

% clustalw RF00005.fa
% ipknot -e Boltzmann RF00005.aln
>J01390-1/6861-6
--------CAGGUUAGAGCCAGGUGGUU--AGGCGUCUUGUUUGGGUCAAGAAAUU-GUUAUGUUCGAAUCAUAAUAACCUGA-
........(((((((..(((...........))).(((((.......)))))......(((((.......))))))))))))..

Folding with constraints

IPknot can fold a given sequence or alignment with some constraints. The constraint is given by a 2-columned TSV file. The first column indicates the position i of the base to be constrained. If the second column is given by the number j, this line means a base-pair constraint, that is, ith base and jth base form a base pair. If the second column is respectively given by a character x, |, <, >, the ith base should be unpaired, paired with another base, paired with a downstream base, paired with a upstream base, respectively.

% cat constraint.txt
16 100
41 x
42 x
% ipknot -c constraint.txt drz_Ppac_1_1.fa
>drz_Ppac_1_1
GACUCGCUUGACUGUUCACCUCCCCGUGGUGCGAGUUGGACACCCACCACUCGCAUUCUUCACCUAUUGUUUAAUUGUGCUUGUGGUGGGUGACUGAGAAACAGUC
.........(((((((............(((((((.........[[[[[)))))))....((((...................]]]]])))).......)))))))

This example shows folding with constraints that 16th base and 100th base are paired, 41st and 42nd bases are unpaired.

Run with Docker

docker build . -t ipknot
docker run -it --rm -v $(pwd):$(pwd) -w $(pwd) ipknot ipknot examples/RF00005.fa

Run with the web server

The IPknot web server is available at http://ws.sato-lab.org/rtips/ipknot++/.

References

  • Sato, K., Kato, Y.: Prediction of RNA secondary structure including pseudoknots for long sequences, Brief. Bioinform., 23(1):bbab395 (Jan. 2022)
  • Sato, K., Kato, Y., Hamada, M., Akutsu, T., Asai, K.: IPknot: fast and accurate prediction of RNA secondary structures with pseudoknots using integer programming, Bioinformatics, 27(13):i85-i93 (Jul. 2011)

About

Integer programming based prediction of RNA secondary structures with pseudoknots

Resources

Stars

23 stars

Watchers

3 watching

Forks

Releases

Packages

Contributors

Languages